Sequence retrieval

Genome: Deinococcus gobiensis I-0
Start position: 1931310
End position: 1931333
Length: 24

DNA sequence
>NC_017790, from 1931310 to 1931333 (24 bp); Deinococcus gobiensis I-0 CAGCGGCAGCCGCAGCGCCAGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1930612-1931379	Sequence	DGo_CA1789 - Amino acid ABC transporter, permease protein (Protein is coded in complementary strand; from 1931379 to 1930612)