Sequence retrieval

Genome: Deinococcus gobiensis I-0
Start position: 1930206
End position: 1930229
Length: 24

DNA sequence
>NC_017790, from 1930206 to 1930229 (24 bp); Deinococcus gobiensis I-0 GCTCAGGCCCAGGCTGAGGCTCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1929775-1930530	Sequence	DGo_CA1788 - hypothetical protein (Protein is coded in complementary strand; from 1930530 to 1929775)