Sequence retrieval

Genome: Deinococcus gobiensis I-0
Start position: 1902071
End position: 1902097
Length: 27

DNA sequence
>NC_017790, from 1902071 to 1902097 (27 bp); Deinococcus gobiensis I-0 CCCGTTCCCCCCGTTCCCCCCGTTCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1899335-1902619	Sequence	DGo_CA1765 - sensory box sensor histidine kinase (Protein is coded in complementary strand; from 1902619 to 1899335)