Sequence retrieval

Genome: Deinococcus gobiensis I-0
Start position: 1881487
End position: 1881510
Length: 24

DNA sequence
>NC_017790, from 1881487 to 1881510 (24 bp); Deinococcus gobiensis I-0 GATCGTGATCGGCATCGTGATCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1880874-1882109	Sequence	DGo_CA1748 livM Branched-chain amino acid ABC transporter, permease protein