Sequence retrieval

Genome: Deinococcus gobiensis I-0
Start position: 1764381
End position: 1764404
Length: 24

DNA sequence
>NC_017790, from 1764381 to 1764404 (24 bp); Deinococcus gobiensis I-0 CCCAGCGCCAGCCCCAGGACCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1763814-1764464	Sequence	DGo_CA1637 - Cytochrome c-type biogenesis protein CcmB (Protein is coded in complementary strand; from 1764464 to 1763814)