Sequence retrieval

Genome: Deinococcus gobiensis I-0
Start position: 1516848
End position: 1516871
Length: 24

DNA sequence
>NC_017790, from 1516848 to 1516871 (24 bp); Deinococcus gobiensis I-0 GCCCAGCCCCAGCCCCAGGCCCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1516429-1517271	Sequence	DGo_CA1396 - Phosphoesterase, PA-phosphatase related protein (Protein is coded in complementary strand; from 1517271 to 1516429)