Sequence retrieval

Genome: Deinococcus gobiensis I-0
Start position: 1422588
End position: 1422614
Length: 27

DNA sequence
>NC_017790, from 1422588 to 1422614 (27 bp); Deinococcus gobiensis I-0 TCGGTGCCGTCGATGCCGTCGGTGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1422393-1423613	Sequence	DGo_CA1302 - Hydroxypyruvate reductase TtuD (Protein is coded in complementary strand; from 1423613 to 1422393)