Sequence retrieval

Genome: Deinococcus gobiensis I-0
Start position: 1319027
End position: 1319050
Length: 24

DNA sequence
>NC_017790, from 1319027 to 1319050 (24 bp); Deinococcus gobiensis I-0 CGACCACGACCGCGATCACGGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1318990-1319889	Sequence	DGo_CA1210 - Tetratricopeptide TPR_2 (Protein is coded in complementary strand; from 1319889 to 1318990)