Sequence retrieval

Genome: Deinococcus gobiensis I-0
Start position: 1291436
End position: 1291480
Length: 45

DNA sequence
>NC_017790, from 1291436 to 1291480 (45 bp); Deinococcus gobiensis I-0 GACCTCGCCGCCCAGCTCCTCACCGCCCAGCACCTCGCCACTCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1291395-1293176	Sequence	DGo_CA1180 - Glycosyl hydrolase, family 13 (Protein is coded in complementary strand; from 1293176 to 1291395)