Sequence retrieval

Genome: Deinococcus gobiensis I-0
Start position: 126428
End position: 126463
Length: 36

DNA sequence
>NC_017790, from 126428 to 126463 (36 bp); Deinococcus gobiensis I-0 CGAGGGCCGCAGCGGGGGCAGCAGTGAGGGGCGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 125619-126806	Sequence	DGo_CA0119 - Carbohydrate kinase FGGY (Protein is coded in complementary strand; from 126806 to 125619)