Sequence retrieval

Genome: Deinococcus gobiensis I-0
Start position: 1080619
End position: 1080663
Length: 45

DNA sequence
>NC_017790, from 1080619 to 1080663 (45 bp); Deinococcus gobiensis I-0 GGGCTGGACCGGCGCGGGCTGCATGGGCGCGGGGCGCACCGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1080386-1081195	Sequence	DGo_CA0983 - S-layer protein (Protein is coded in complementary strand; from 1081195 to 1080386)