Sequence retrieval

Genome: Helicobacter cinaedi PAGU611
Start position: 1144241
End position: 1144267
Length: 27

DNA sequence
>NC_017761, from 1144241 to 1144267 (27 bp); Helicobacter cinaedi PAGU611 CATCGCCGCCATCGCCGCCATCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1143217-1144371	Sequence	HCN_1123 obgE GTPase ObgE (Protein is coded in complementary strand; from 1144371 to 1143217)