Sequence retrieval

Genome: Helicobacter cinaedi PAGU611
Start position: 2031647
End position: 2031691
Length: 45

DNA sequence
>NC_017761, from 2031647 to 2031691 (45 bp); Helicobacter cinaedi PAGU611 TTTAGAATCTAGCCGTTTAGAATCTTCTCGCTTAGAATCTAGTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2030787-2032055	Sequence	HCN_2053 - hypothetical protein (Protein is coded in complementary strand; from 2032055 to 2030787)