Sequence retrieval

Genome: Helicobacter cinaedi PAGU611
Start position: 400391
End position: 400420
Length: 30

DNA sequence
>NC_017761, from 400391 to 400420 (30 bp); Helicobacter cinaedi PAGU611 TTTATTCATTTTTATCCTTTTTTTTTCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 399399-400400	Sequence	HCN_0390 - DNA polymerase III subunit delta (Protein is coded in complementary strand; from 400400 to 399399)
ORF... 400403-402472	Sequence	HCN_0391 - ribonuclease R (Protein is coded in complementary strand; from 402472 to 400403)