Sequence retrieval

Genome: Helicobacter cinaedi PAGU611
Start position: 2635
End position: 2664
Length: 30

DNA sequence
>NC_017761, from 2635 to 2664 (30 bp); Helicobacter cinaedi PAGU611 CATTAGTTTAGATGAGTTTAGATGAGTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1454-2641	Sequence	HCN_0002 - major facilitator superfamily protein
ORF... 2643-4604	Sequence	HCN_0003 recG ATP-dependent DNA helicase RecG (Protein is coded in complementary strand; from 4604 to 2643)