Sequence retrieval

Genome: Helicobacter cinaedi PAGU611
Start position: 534228
End position: 534254
Length: 27

DNA sequence
>NC_017761, from 534228 to 534254 (27 bp); Helicobacter cinaedi PAGU611 GCATCAATATCATCAATAGCATCAACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 533904-534587	Sequence	HCN_0520 - molybdopterin biosynthesis protein (Protein is coded in complementary strand; from 534587 to 533904)