Sequence retrieval

Genome: Helicobacter cinaedi PAGU611
Start position: 237641
End position: 237667
Length: 27

DNA sequence
>NC_017761, from 237641 to 237667 (27 bp); Helicobacter cinaedi PAGU611 ATTATCAACATTACCAACATTATCAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 236889-238394	Sequence	HCN_0222 - hypothetical protein (Protein is coded in complementary strand; from 238394 to 236889)