Sequence retrieval

Genome: Helicobacter cinaedi PAGU611
Start position: 1492411
End position: 1492435
Length: 25

DNA sequence
>NC_017761, from 1492411 to 1492435 (25 bp); Helicobacter cinaedi PAGU611 AAAAAGAAAAAAGAAATAAACAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1492047-1492454	Sequence	HCN_1511 - hypothetical protein (Protein is coded in complementary strand; from 1492454 to 1492047)