Sequence retrieval

Genome: Helicobacter cinaedi PAGU611
Start position: 710830
End position: 710853
Length: 24

DNA sequence
>NC_017761, from 710830 to 710853 (24 bp); Helicobacter cinaedi PAGU611 AGCACAAGCTCAAGCATAAGCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 710227-712215	Sequence	HCN_0695 - hypothetical protein (Protein is coded in complementary strand; from 712215 to 710227)