Sequence retrieval

Genome: Helicobacter cetorum MIT 00-7128
Start position: 322766
End position: 322829
Length: 64

DNA sequence
>NC_017737, from 322766 to 322829 (64 bp); Helicobacter cetorum MIT 00-7128 GTATTGTTGTATTGTTGTATTGTTGTATTGTTGTATTGTTGTATTGTTGTATTGTTGTATTGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 321196-322851	Sequence	HCW_01615 - outer membrane protein 27 (Protein is coded in complementary strand; from 322851 to 321196)