Sequence retrieval

Genome: Helicobacter cetorum MIT 00-7128
Start position: 1866186
End position: 1866221
Length: 36

DNA sequence
>NC_017737, from 1866186 to 1866221 (36 bp); Helicobacter cetorum MIT 00-7128 TTTTAAGTTCTGTTTTAAGTTCTGTTTTAAGTTCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1865186-1866775	Sequence	HCW_08470 - type I restriction-modification system specificity protein (Protein is coded in complementary strand; from 1866775 to 1865186)