Sequence retrieval

Genome: Helicobacter cetorum MIT 00-7128
Start position: 1248340
End position: 1248402
Length: 63

DNA sequence
>NC_017737, from 1248340 to 1248402 (63 bp); Helicobacter cetorum MIT 00-7128 CAAATTCTTTATTTTCTTCATCAAATTCTTTATTTTCTTCATCAAATTCTTTATTTTCTTCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1248258-1248869	Sequence	HCW_05770 - hypothetical protein (Protein is coded in complementary strand; from 1248869 to 1248258)