Sequence retrieval

Genome: Corynebacterium pseudotuberculosis 31
Start position: 2189608
End position: 2189637
Length: 30

DNA sequence
>NC_017730, from 2189608 to 2189637 (30 bp); Corynebacterium pseudotuberculosis 31 CCCACGCACAACCACACACACCCACACAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
2188117-2191192	Sequence	Cp31_r11 23S ribosomal RNA (Protein is coded in complementary strand; from 2191192 to 2188117)