Sequence retrieval

Genome: Corynebacterium pseudotuberculosis 31
Start position: 1702930
End position: 1702953
Length: 24

DNA sequence
>NC_017730, from 1702930 to 1702953 (24 bp); Corynebacterium pseudotuberculosis 31 CGGCGACCGCGACGGCGACGACGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1700299-1703703	Sequence	Cp31_1584 rne Ribonuclease E/G family (Protein is coded in complementary strand; from 1703703 to 1700299)