Sequence retrieval

Genome: Corynebacterium pseudotuberculosis 31
Start position: 1691866
End position: 1691898
Length: 33

DNA sequence
>NC_017730, from 1691866 to 1691898 (33 bp); Corynebacterium pseudotuberculosis 31 CCTATTCCGATCAGATTCCGATCAGATTCCGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1691899-1693185	Sequence	Cp31_1576 proA gamma-glutamyl phosphate reductase (Protein is coded in complementary strand; from 1693185 to 1691899)