Sequence retrieval

Genome: Corynebacterium pseudotuberculosis 31
Start position: 1123784
End position: 1123807
Length: 24

DNA sequence
>NC_017730, from 1123784 to 1123807 (24 bp); Corynebacterium pseudotuberculosis 31 GCAACGGCAAGGGCAATGCCAACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1123751-1125058	Sequence	Cp31_1053 dcuA Anaerobic C4-dicarboxylate transporter (Protein is coded in complementary strand; from 1125058 to 1123751)