Sequence retrieval

Genome: Escherichia coli O55:H7 str. RM12579
Start position: 945283
End position: 945327
Length: 45

DNA sequence
>NC_017656, from 945283 to 945327 (45 bp); Escherichia coli O55:H7 str. RM12579 TGCAAAAGCAGCAGCTGAAAAAGCCGCTGCAGCAAAAGCTGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 944487-945719	Sequence	ECO55CA74_04410 tolA cell envelope integrity inner membrane protein TolA