Sequence retrieval

Genome: Escherichia coli O55:H7 str. RM12579
Start position: 78386
End position: 78409
Length: 24

DNA sequence
>NC_017656, from 78386 to 78409 (24 bp); Escherichia coli O55:H7 str. RM12579 GCAGCAACAGCAGCAGCGCCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 77686-79296	Sequence	ECO55CA74_00340 thiP thiamine transporter membrane protein (Protein is coded in complementary strand; from 79296 to 77686)