Sequence retrieval

Genome: Escherichia coli O55:H7 str. RM12579
Start position: 53242
End position: 53265
Length: 24

DNA sequence
>NC_017656, from 53242 to 53265 (24 bp); Escherichia coli O55:H7 str. RM12579 CTGGCGGTGGCGCTGTCGATGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 52160-54022	Sequence	ECO55CA74_00235 - glutathione-regulated potassium-efflux system protein KefC