Sequence retrieval

Genome: Escherichia coli O55:H7 str. RM12579
Start position: 5191386
End position: 5191409
Length: 24

DNA sequence
>NC_017656, from 5191386 to 5191409 (24 bp); Escherichia coli O55:H7 str. RM12579 TATCTTTATCTTTATCTTTATCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5189579-5191780	Sequence	ECO55CA74_24755 - non-LEE-encoded type III secreted effector (Protein is coded in complementary strand; from 5191780 to 5189579)