Sequence retrieval

Genome: Escherichia coli O55:H7 str. RM12579
Start position: 5113853
End position: 5113906
Length: 54

DNA sequence
>NC_017656, from 5113853 to 5113906 (54 bp); Escherichia coli O55:H7 str. RM12579 GCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5113565-5114737	Sequence	ECO55CA74_24495 - hypothetical protein (Protein is coded in complementary strand; from 5114737 to 5113565)