Sequence retrieval

Genome: Escherichia coli O55:H7 str. RM12579
Start position: 4696129
End position: 4696152
Length: 24

DNA sequence
>NC_017656, from 4696129 to 4696152 (24 bp); Escherichia coli O55:H7 str. RM12579 AATGCCAATGGCGATGCCAATTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4695422-4696213	Sequence	ECO55CA74_22585 - rhamnose-proton symporter (Protein is coded in complementary strand; from 4696213 to 4695422)