Sequence retrieval

Genome: Escherichia coli O55:H7 str. RM12579
Start position: 4396710
End position: 4396733
Length: 24

DNA sequence
>NC_017656, from 4396710 to 4396733 (24 bp); Escherichia coli O55:H7 str. RM12579 GCAGTTTCAGTTGCACTTGCAGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4395873-4397561	Sequence	ECO55CA74_21195 - translocated intimin receptor Tir (Protein is coded in complementary strand; from 4397561 to 4395873)