Sequence retrieval

Genome: Escherichia coli O55:H7 str. RM12579
Start position: 2438328
End position: 2438363
Length: 36

DNA sequence
>NC_017656, from 2438328 to 2438363 (36 bp); Escherichia coli O55:H7 str. RM12579 TATTCTCTGTAGTAATCTCTGTTGTATTCTCTGTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2437862-2438827	Sequence	ECO55CA74_11910 - phage O protein family (Protein is coded in complementary strand; from 2438827 to 2437862)