Sequence retrieval

Genome: Escherichia coli O55:H7 str. RM12579
Start position: 2422690
End position: 2422719
Length: 30

DNA sequence
>NC_017656, from 2422690 to 2422719 (30 bp); Escherichia coli O55:H7 str. RM12579 GCGGCATTTAGCGGCATTTAGCGGCATTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2422708-2422902	Sequence	ECO55CA74_11810 - hypothetical protein (Protein is coded in complementary strand; from 2422902 to 2422708)