Sequence retrieval

Genome: Escherichia coli O55:H7 str. RM12579
Start position: 2355342
End position: 2355365
Length: 24

DNA sequence
>NC_017656, from 2355342 to 2355365 (24 bp); Escherichia coli O55:H7 str. RM12579 CCACCAGCACCACCAGCAGCACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2355129-2356535	Sequence	ECO55CA74_11430 fliD flagellar capping protein