Sequence retrieval

Genome: Escherichia coli O55:H7 str. RM12579
Start position: 1996355
End position: 1996390
Length: 36

DNA sequence
>NC_017656, from 1996355 to 1996390 (36 bp); Escherichia coli O55:H7 str. RM12579 TATTCTCTGTAGTAATCTCTGTTGTATTCTCTGTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1995889-1996854	Sequence	ECO55CA74_09635 - hypothetical protein (Protein is coded in complementary strand; from 1996854 to 1995889)