Sequence retrieval

Genome: Escherichia coli O55:H7 str. RM12579
Start position: 1601797
End position: 1601821
Length: 25

DNA sequence
>NC_017656, from 1601797 to 1601821 (25 bp); Escherichia coli O55:H7 str. RM12579 AGCAGAGCAGAACAGAGCATACCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1600053-1603319	Sequence	ECO55CA74_07670 - tail length tape measure protein