Sequence retrieval

Genome: Escherichia coli O55:H7 str. RM12579
Start position: 1277405
End position: 1277428
Length: 24

DNA sequence
>NC_017656, from 1277405 to 1277428 (24 bp); Escherichia coli O55:H7 str. RM12579 ATTGGGATTGTGATTGGCATTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1277340-1278512	Sequence	ECO55CA74_06015 - trimethylamine N-oxide reductase cytochrome c-type subunit