Sequence retrieval

Genome: Escherichia coli W
Start position: 75286
End position: 75309
Length: 24

DNA sequence
>NC_017635, from 75286 to 75309 (24 bp); Escherichia coli W GCAGCAACAGCAGCAGCGCCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 74586-76196	Sequence	ECW_m0065 thiP fused thiamin transporter subunits of ABC superfamily: membrane components (Protein is coded in complementary strand; from 76196 to 74586)