Sequence retrieval

Genome: Escherichia coli W
Start position: 4419455
End position: 4419484
Length: 30

DNA sequence
>NC_017635, from 4419455 to 4419484 (30 bp); Escherichia coli W CGCGGTAAATCTCGATAAATGGCGGTAATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4418344-4419495	Sequence	ECW_m4313 argE acetylornithine deacetylase (Protein is coded in complementary strand; from 4419495 to 4418344)