Sequence retrieval

Genome: Escherichia coli W
Start position: 4325695
End position: 4325718
Length: 24

DNA sequence
>NC_017635, from 4325695 to 4325718 (24 bp); Escherichia coli W AATGCCAATGGCGATGCCAATTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4324988-4326022	Sequence	ECW_m4216 rhaT L-rhamnose/L-lyxose transporter (Protein is coded in complementary strand; from 4326022 to 4324988)