Sequence retrieval

Genome: Escherichia coli W
Start position: 4210788
End position: 4210817
Length: 30

DNA sequence
>NC_017635, from 4210788 to 4210817 (30 bp); Escherichia coli W GGTGCAGGTGCAGGTGCAGGTGCAGGTGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4210749-4211948	Sequence	ECW_m4104 hemX uroporphyrinogen III methylase (Protein is coded in complementary strand; from 4211948 to 4210749)