Sequence retrieval

Genome: Escherichia coli W
Start position: 3901097
End position: 3901120
Length: 24

DNA sequence
>NC_017635, from 3901097 to 3901120 (24 bp); Escherichia coli W CACCAGCACCAGCGCCAGCAGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3900657-3901559	Sequence	ECW_m3808 dppC dipeptide transporter (Protein is coded in complementary strand; from 3901559 to 3900657)