Sequence retrieval

Genome: Escherichia coli W
Start position: 339444
End position: 339467
Length: 24

DNA sequence
>NC_017635, from 339444 to 339467 (24 bp); Escherichia coli W TGAGGGAGAGGGTTAGGGTGAGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 339462-340205	Sequence	ECW_m0331 lfgH flagellar protein of basal-body outer-membrane L ring