Sequence retrieval

Genome: Escherichia coli W
Start position: 2048891
End position: 2048914
Length: 24

DNA sequence
>NC_017635, from 2048891 to 2048914 (24 bp); Escherichia coli W CGGGATCGGCATCGGCATCGGGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2048166-2049722	Sequence	ECW_m1986 yoaE hypothetical protein (Protein is coded in complementary strand; from 2049722 to 2048166)