Sequence retrieval

Genome: Escherichia coli W
Start position: 1791431
End position: 1791466
Length: 36

DNA sequence
>NC_017635, from 1791431 to 1791466 (36 bp); Escherichia coli W TATTCTCTGTAGTAATCTCTGTTGTATTCTCTGTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1790965-1791930	Sequence	ECW_m1731 - hypothetical protein (Protein is coded in complementary strand; from 1791930 to 1790965)