Sequence retrieval

Genome: Escherichia coli W
Start position: 1165558
End position: 1165581
Length: 24

DNA sequence
>NC_017635, from 1165558 to 1165581 (24 bp); Escherichia coli W ATTGGGATTGTGATTGGCATTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1165493-1166665	Sequence	ECW_m1106 torC trimethylamine N-oxide (TMAO) reductase I, cytochrome c-type subunit