Sequence retrieval

Genome: Escherichia coli UM146
Start position: 4838032
End position: 4838055
Length: 24

DNA sequence
>NC_017632, from 4838032 to 4838055 (24 bp); Escherichia coli UM146 GCAGCAACAGCAGCAGCGCCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4837332-4838942	Sequence	UM146_23130 thiP thiamine transporter membrane protein (Protein is coded in complementary strand; from 4838942 to 4837332)