Sequence retrieval

Genome: Escherichia coli UM146
Start position: 4526336
End position: 4526359
Length: 24

DNA sequence
>NC_017632, from 4526336 to 4526359 (24 bp); Escherichia coli UM146 AGCAGAAGGAGAAACAGAAGCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4524989-4526362	Sequence	UM146_21620 - hypothetical protein (Protein is coded in complementary strand; from 4526362 to 4524989)